nuntium

Polymerase reactionem catenae (PCR)

AP.BIO:

IST‑1 (EU)

,

IST‑1.P(LO)

,

IST‑1.P.1 (EK)

Solebat ars amplificandi vel plura exemplaria in regione DNA certae scopo.

 

Cardinis:

  • Polymerase catenis reactionem, or PCR, ars est ad multa exemplaria regionis DNA specificae facienda in vitro (Per tubo uitreo magis quam organismo).
  • pcr nititur DNA polymerase thermostica; Taq polymeraseet DNA requirit primers nominatim pro DNA regione interest.
  • In PCR, reactionem saepe revolvitur per seriem mutationum temperaturae, quae multa exemplaria regionis scopum produci sinunt.
  • PCR multas investigationes et usus habet practicas. Usurpatur in DNA exquisitis, diagnosticis medicis, et in DNA analysi forensi.

Quid est pcr?

Polymerase catenis reactionem (PCR) est ars laboratoria communis multis exemplaribus (millions decies centena milia vel billions!) alicuius regionis DNA reddere. Haec DNA regio potest aliquid esse experimentum cuius interest. Exempli gratia potest esse gena cuius munus indagator intellegere vult, vel geneticus titulus a phisicis forensibus usus est ut scaenam criminis DNA cum suspicionibus insereret.

Typice propositum PCR est satis facere scopo DNA regionis quod enucleari vel alio modo adhiberi potest. Exempli gratia, DNA per PCR ampliata arcessi potest sequencing, subjicitur per gel electrophoresis, or cloned in plasmido ad ulteriora experimenta.

PCR in multis locis biologiae et medicinae adhibetur, inclusis investigationibus biologiae hypotheticae, diagnosticis medici, et etiam nonnullis ramis oecologicis.

Taq polymerase

sicut DNA replicatio in organismo, PCR enzymum polymerasium DNA requirit quod fila nova DNA facit, fila exsistentia ut templates. DNA polymerase typice usus est in PCR dicitur Taq polymerasepost bacterium caloris a quo semotus fuitThermus aq *uaticus).

T. aquaticus vivit in fontibus calidis et spiraculis hydrothermalibus. DNA polymerasis eius est valde stabilis et acerrima circa 70°\textus C70°C70, °, textus incipiendi, C, finis textus (temperatus in quo homo vel E. coli DNA polymerasis non munus est). Haec stabilitas caloris facit specimen Taq polymerase PCR. Ut videbimus, caliditas saepe in PCR to . adhibetur denature template DNA, seu fila eius separare.

PCR primers

Sicut alii DNA polymerases; Taq polymerase non solum ut DNA si suus 'data est' primario, brevis series nucleotidis quae initium praebet synthesi DNA. In PCR reactione, experimentator regionem DNA designat, quae ex primariis ipsa vel eligit vel amplianda erit, vel amplianda.

PCR primarii breves sunt fragmenta DNA simplicium subductis, plerumque circiter 202020 nucleotidis longitudinis. Duo primarii in singulis per reactionem adhibentur, et ordinantur ut scopo regionem circumcludant (regionem quae exscribenda est). Hoc est, sequentia data sunt, quae eos ligare faciet ad fila opposita templates DNA, sicut ad margines regionis transcribendae. Primarii ad formulam ligant per bases complementarias.

Formula DNA:

5′ TATCAGATCCATGGAGT... GAGTACTAGTCCTAGTGAGT 3′ 3′ ATAGTCTAGGTACCTCA…CTCATGATCAGGATACTCA 5′

Primario 1: 5′ CAGATCCATGG 3′ Primario 2:

Cum primarii ad Formulae tenentur, a polymerase extendi possunt, et regio quae inter eos iacet transcripta erit.

[Plura explicatio tabulae ostensionis DNA et primario directionality]

Gradus PCR

The key ingredients of a PC reaction are Taq polymerase, primers, template DNA, et nucleotides (DNA caudices construendi). Medicamenta in tubum coacervantur, cum cofactoribus enzyme necessariis, et ponuntur per crebras cyclos calefactionis et refrigerationis, quae DNA perstringi sinunt.

Gradus fundamentales sunt:

  1. Denaturation (96°\text C96°C96, °, text, C, end, text): Cale reactionem vehementer separare, seu denature, fila DNA. Hoc unum praebet template subductis gradum proximum.
  2. Annealing (555555-656565°\text C°C°, text, C, end text): Frigus reactionem ut primers ligare possunt ad eorum sequentia complementaria in the single-stranded template DNA.
  3. Extensio (72°\text C72°C72, °, text, C, fine text): Tolle reactionem temperaturis Taq polymerasis primarios porrigit, novas fila DNA componens.

Hic cyclus repetit 252525 - 353535 temporibus in typica PCR reactionis, quae plerumque 222 - 444 horas accipit, secundum longitudinem DNA regionis exscriptam. Si reactio efficiens (bene operatur), scopum regionis ab uno vel paucis exemplaribus ad billions tantum exire potest.

Id quod non solum originale DNA est, ut exemplum cuiusque temporis usus est. Instead, nova DNA quae in uno rotundo facta est ut exemplum in altera circum synthesin DNA servire potest. Sunt multa exemplaria primariorum et multae moleculae Taq polymerasium circum volitans in reactione, sic numerus DNA molecularum in unaquaque gyrationis circumlatione dure potest duplicare. Praefecti incrementi exponentialis infra imaginem ostenditur.

Utens electronica electronica ad visualize eventus PCR

Eventus PCR reactionem plerumque subjicitur (visibilis factus) utens gel electrophoresisgel electrophoresis ars est in qua fragmenta DNA per vulvam electrici currens trahuntur, et DNA fragmenta secundum magnitudinem separat. Vexillum seu DNA scala proprie includitur ut magnitudo fragmentorum in PCR sample determinari possit.

DNA fragmenta eiusdem longitudinis "globum" in gel formant, quod per oculum videri potest, si gel tinctura DNA ligatorio maculata sit. Exempli gratia, PCR reactionem faciens 400400400 par basin (bp) fragmentum in gel simile spectare videtur:

Lane sinistrae: DNA scala cum 100, 200, 300, 400, 500 bp fasciae.

Ius lane: effectus per reactionem, globus 400 bp.

Cohors DNA multa continet, multa exemplaria regionis DNA scopo, non uno vel paucis exemplaribus. Quia DNA microscopica est, multorum exemplarium adesse debet antequam eam per oculum videre possimus. Haec magna pars est quare PCR instrumentum magni momenti est: satis efficit exempla sequentiae DNA, quam videre vel mutare possumus regionem DNA.

Applications PCR

Utens PCR, series DNA decies centena millia vel billiones temporum ampliari potest, satis DNA exemplaria producens ut aliis artificiis enucleetur. Exempli gratia, DNA subjici potest a electrophoresi gel accita sequencingaut coquatur restrictione enzymes et cloned in plasmid.

PCR in multis investigationibus labs adhibitis, etiam practicas applicationes in causis forensibus, experimentis geneticis et diagnosticis habet. Exempli gratia, PCR augere genes geneticas perturbationes geneticas ex DNA aegrorum (vel ex DNA foetus in casu praenatalis probati) adsciverunt. PCR etiam adhiberi potest ad experiendum bacterium vel DNA virus in corpore patientis: si pathogen adest, ampliare potest regiones eius DNA ex sanguine vel textu sample amplificare.

Sample problem: PCR in forensics

Puta te in forensibus lab. Modo DNA specimen e capillo relictum sceleris scaenae accepisti, cum DNA speciminibus tribus possibilibus suspectis. Officium tuum est specialem titulum geneticum explorare et videre num quis trium suspectorum comis DNA huic titulo compositus sit.

Titulus venit in duas allelas, seu versiones. Unum repetere (regionem fuscam infra), altera duo exemplaria repetita continet. In a PCR reactione cum primariis, quae in regione repetuntur, prima allela producit textum 200200200 \text{bp}bpstart, b, p, textum DNA fragmentum, dum secunda producit 300300300 \text{bp}bpstart text, b a, p, text: DNA fragmentum;

Allelae 1: primers circumfusi repetere regionem ampliant CC bp fragmenti DNA

Allelae 2: primers circumfusi repetere regionem ampliant 300 bp fragmenti DNA

Perficas PCR in quattuor DNA speciminibus et efficis eventus per electrophoresin gel, ut infra ostendetur:

Gel habet quinque vicos;

Primae lane: DNA scala cum 100, 200, 300, 400, et 500 bp vinculis.

Secundus lane: DNA a scelere scena, 200 bp band.

Tertius lane: Suspice # I DNA, 300 bp band.

Quartus lane: Suspectus #2 DNA, 200 et 300 vincula bp.

Quintus lane: Suspectus #3 DNA, 200 band bp.

Quae suspicio DNA aequet DNA criminis scaena in hoc titulo?

Elige I responsum:

Elige I responsum:

(A optio)

A

suspicio 111

(electio B)

B

Suspice 222

(Chice C)

C

Suspice 333

(D electionis)

D

Nemo suspicatur

[Hint]

Non potuimus gradu tuo respondere. Is vultus amo quod egressus es inanis aut in irritum responsum intravit.

Check

Plus de PCR et forensics

In probationibus realibus forensibus DNA ex scaena criminis, technici analysin rationem facerent similem illi in exemplo supra dicto. Plures tamen figuli diversi (non unicus in exemplo notati) inter scaenam criminis DNA et suspectos' DNA comparari volunt.

Etiam figuli adhibiti in analysi forensi typica non veniunt in duabus tantum diversis formis. Sed valde polymorphic (poly- = multis; morph = forma). Hoc est, veniunt in multis allelarum, quae in minimis longitudinis incrementis variant.

Frequentissimum genus venalicium in forensibus appellabatur breviter tandem repetit (STRs) , ex pluribus exemplaribus eiusdem brevitatis nucleotidis sequentiarum repetitis (typice 222 ad 555 nucleotides longae). Una allela STR, ut 202020 repetit, alia 181818, alia mox 101010^11 incipit superscript, 1, fine superscript.

Multiplices figentes examinando, quarum unaquaeque in multis allelarum formis venit, phisici forenses singularem geneticam "digitum" ex DNA exemplo aedificare possunt. In analysis STR typica utentes 131313 figuli, dissident falsae affirmativae (duo homines eundem DNA "digitum" habentes) minores sunt quam 111 in 101010 \textu{billion}billion initti, b, i, l, l, i; o, n, finis textus superscript, 1, finis superscript!

Licet cogitare de DNA probationibus adhibitis ad scelestos convictos, hoc maximum munus est in excusatione populi falso accusati (inclusis nonnullis per multos annos conclusi). Analysis forensis quoque usus est ad paternitatem stabiliendam et ad cognoscendas humanas reliquias ex calamitatibus scaenarum.

[Attribution and references]

Esne discipulus an magister?

StudentTeacher

 


Post tempus: Jan-08-2021